CICA Tech Sharing: NTT-seq
Please visit NTT-seq.com
On the NTT-seq website you’ll find information on protocols, reagents, sequencing, computational tools, and FAQ.
Each NTT-seq Starter Kit contains the following reagents:
2x transposome complexes- Store at 4°C
24 µl α-mouse-Tn5 (3 µl/ rxn)
24 µl α-rabbit-Tn5(3 µl/ rxn)
2x custom sequencing oligos- Store at 4°C
60 µl Illumina_Custom_R1, 100 µM (6 µl/ rxn)
60 µl Illumina_Custom_i5, 100 µM (6 µl/ rxn)
2x commercial antibodies- Store at -20°C
8 µl H3K27me3_Active Motif_61017 (1 µl/ rxn)
8 µl H3K27ac_Abcam_ab4729 (1 µl/ rxn)
Protocol
The full protocol is detailed in the NTT-seq manuscript
We do see variability from tissue to tissue and sample to sample. We suggest optimizing your experiment in-bulk with standard CUT&Tag prior to proceeding with NTT-seq. [And if you already have CUT&Tag running in your lab feel free to follow your own protocol.]
If you are not familiar with the CUT&Tag protocol, we suggest to start here: https://www.protocols.io/view/single-cell-cut-and-tag-on-10x-genomics-platform-6qpvrd392gmk/v1 and adjust the protocol to stain with two antibodies instead of one and two nb-Tn5 complexes instead of one pA-Tn5.
Oligos are similar to those in the sci-ATAC-seq protocol (https://teichlab.github.io/scg_lib_structs/methods_html/sci-ATAC-seq.html) with the only difference being we barcoded only one side of the oligo instead of both like they do in the paper. The sequences we have in the kit are:
Custom_R1 GCGATCGAGGACGGCAGATGTGTATAAGAGACAG
Custom_i5 CTGTCTCTTATACACATCTGCCGTCCTCGATCGC
ME_19_Phos /5phos/CTGTCTCTTATACACATCT
NTT_R1_A (Mouse) TCGTCGGCAGCGTC GTCAAGGA GCGATCGAGGACGGCAGATGTGTATAAGAGACAG
NTT_R1_B (Rabbit) TCGTCGGCAGCGTC CAGAGCGT GCGATCGAGGACGGCAGATGTGTATAAGAGACAG
MEDS_B_NTT_R2 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
Sample adapter annealing reagents:
1. Med_A for mouse
60 ul 100 uM NTT_R1_A
60 ul 100 uM ME_19_Phos
2.4 ul 2.5 M NaCl
2. Med_A for rabbit
60 ul 100uM NTT_R1_B
60 ul 100uM ME_19_Phos
2.4 ul 2.5 M NaCl
3. MED_B
110 ul 100 uM MEDS_B_NTT_R2
110 ul 100 uM ME_19_Phos
4.4 ul 2.5 M NaCl
Sample transposome assembly reagents:
10 ul nanobody (mouse, rabbit)
2 ul annealed adapter MED_A (mouse or rabbit)
2 ul annealed adapter MED_B
In early 2022, we introduced nanobody-tethered transposition followed by sequencing (NTT-seq), a new assay capable of measuring the genome-wide presence of multiple histone modifications and protein-DNA binding sites at single-cell resolution. NTT-seq utilizes recombinant Tn5 transposase fused to a set of secondary nanobodies (nb). Each nb-Tn5 fusion protein specifically binds to different immunoglobulin-G antibodies, enabling a mixture of primary antibodies binding different epitopes to be used in a single experiment.